Figure 3.CircRNA hsa_circ_0006215 functions as a ceRNA for miR-942-5p regulate the expression of RUNX2 and VEGF. (A) Enrichment of microRNAs by hsa_circ_0006215. (B) Binding of hsa_circ_0006215 to microRNA-942-5p detected using Luciferase reporter gene. (C, D) Binding of hsa_circ_0006215, VEGF and RUNX2 to Ago2 determined by Ago2 RIP. (E) Binding of microRNA to hsa_circ_0006215 determined by microRNA pull down. Western blots show effects of (F) miRNA-942-5p, miRNA-942-5p mimics or inhibitors (CACAUGGCCGAAACAGAGAAG) on RUNX2 and VEGF protein expression, (G) hsa_circ_0006215 on RUNX2 and VEGF protein expression, (H) hsa_circ_0006215 on of RUNX2 and VEGF protein expression after inhibiting microRNA-942-5p function. Effects of hsa_circ_0006215 on (I) BMSC osteogenesis after inhibiting microRNA-942-5p function detected by Alizarin red staining, (J) invasion of HUVEC after inhibiting microRNA-942-5p function using Transwell™ assays. Results are expressed as means ± SD of three independent experiments. *p < 0.05, **p < 0.01.