Aging
Navigate
Back to articleFigure 4(4 of 4)
100%
Figure 4
Figure 4.POT1 inhibits alt-NHEJ efficiency and promotes the degradation of Lig3. (A) Schematic diagram of EJ2-GFP for analyzing the alt-NHEJ efficiency. The mechanism of the reporter cassette is as previously described [6]. (B) Overexpression of POT1 inhibits alt-NHEJ efficiency. The reporter construct was digested with I-SceI restriction enzyme in vitro, followed by being transfected to HCA2-hTERT cells together with a control vector or a plasmid encoding POT1. On day 3 post transfection, cells were harvested for FACS analysis. (C) and (D) Mildly knocking down POT1 in HeLa cells significantly stimulates the alt-NHEJ efficiency. HeLa cells were transfected with siRNA against POT1 twice with two days interval, followed by a transfection of I-SceI linearized EJ2-GFP reporter. On day 3 post transfection, cells were harvested for FACS analysis. (E) Expression of important NHEJ factors in the absence or presence of POT1 overexpression. (F) Quantification of Lig3 expression using ImageJ software. The relative expression of Lig3 is calculated as the ratio of Lig3 expression versus TUBULIN. (G) Lig3 expression was not affected at transcriptional level in POT1 overexpressing cells. At 24 h post POT1 transfection, cells were harvested for mRNA extraction. Then Quantitative PCR analysis was performed with primers indicated. The primers used for q-PCR of Lig3 are as follows: Forward: 5’- TATGGCACGGGACCTAG -3’, Reverse: 5’- CTGTTGCTGCTCATCCTC -3’. The primers used for q-PCR of GAPDH are as follows: Forward: 5’ATGACATCAAGAAGGTGGTG3’, Reverse: 5’CATACCAGGAAATGAGCTTG3’. The transcript level of Lig3 was determined using delta CT method [38]. (H) POT1 overexpression promotes Lig3 degradation. 293FT cells with a control vector or a vector encoding POT1 transfected were treated with cycloheximide (CHX) at 50 μg/ml. At different time points post the treatment, cells were harvested for Western blot analysis. (I) The model of POT1 regulating DNA DSB repair at non-telomeric regions.